How to Win Scholarships? Share your Ideas

Don`t be scared to share your ideas with people especially when you are studying at a University. Testing and trying different things build the attitude of solving problems and makes you sensitive to handle problems effectively.

Most of the students believe that their ideas are not perfect but perfection is a subjective theme. So, don’t use perfection as an excuse.  Proposing and expressing your ideas independently allows you to initiate at a small level to apply the wisdom and experiences of others in multiple ways if you can follow the potential opportunities where you can express your ideas precisely and clearly can contribute hugely in the world along with personal success

ideas

I will share a very small example from my personal experience—

I proposed a few simple experiments to my supervisor which aligned perfectly with the ongoing research in the laboratory.  My supervisor permitted me to execute the idea. The objective of the idea was to replace the standard nutrient or food solution of algae by the cattle waste to reduce the cost of producing algae. If you are a biologist or studying the related field, you might understand it more. Just imagine that you are trying to replace the plastic with bioplastic.

It is usual if you feel a bit anxious in the early stage of research or start-up because of inconsistency and setbacks. You must keep your concentration and consistency in your project where it belongs and learn to respond with a conscious and calm mind. There will be moments when you will think to quit your project which is mostly due to compulsive behavior or desire for quick results. Let them pass as most of the present problems won’t matter in the coming five months. And remind yourself about consistency or any positive experience that you have read will help you overcome the hurdles. These small choices that you will make for your project will be eventful and culture you to become a problem solver. It is your responsibility, but if you quit the project then your responsibility is over, so make your progress. This is why a student should utilize his University time effectively to have that an extra edge among the cream students.

I was learning and unlearning quickly because I was setting up experiments and failing regularly; therefore, I was producing more data and eliminating the things that were not working. Eliminating things in work or research is one of the best ways to increase the efficiency in your decision making and reaching your final professional goal.

Well, the idea of working in a laboratory is different as compared to attending classes as it is not the standard way of learning in the day to day life.  Occasionally, you will have doubts in your strategy as working on a project without any hope of getting a quick reward is not the way the regular school or university teaches you, but it shows you that it takes time to create something new. It will guide you to respect the audacity of your dreams. You will need to strengthen the ideas by diversifying the experiments or conditions.

The experience of undergraduate research will always have a lot to teach you and will give you important questions to think about.

There is always something to learn in every failure which teaches you to create your problem-solving equation. This attitude of working makes you an extended and better version of yourself by developing your planning, long term patients, and communications skills. More importantly, enjoying the experience of science or creating an independent project is the most rewarding feeling. Consistent trying improves your persuading skills which always give you a prejudicial advantage as you will learn to express better.

I made frequent mistakes which caused me to repeat the whole experiment from the starting. Sometimes, it was taking two months to repeat the complete test because of one small error. The results will depend on your efforts and positive mindset to embrace the passion for science and learning from every mistake.

To win scholarships or convince the selection committee, you need to build a strong foundation which will only progress with time and consistent efforts. You need to understand expressing your ideas in words is very critical for your application to be shortlisted for final selection. It gives you the edge over other applicants and increases your success rate in various forms.

Stay tuned. it is about to get more interesting 😉

Advertisements

Nutrition is not Universal and Permanent

The concepts of nutrition changes on regular basis with changes in the technology, market, need and climate. Now, with the social media and fast communication, there is increase in variations in nutrition research and studies with the presence of large number of food and fitness bloggers. It is hard to know “What to Believe and What not”.

It is an interdisciplinary study which has the direct impact on your well-being. It is indeed true that nutrition and diet is only factor that impacts and define your well being but it is in your control- ONE HUNDERED PERCENT. 

The things that I learned after an extensive research through books and research articles, that there is no need to subtract or add extra in your diet if you are consuming the right carbohydrates, proteins, fats, vitamins or minerals and if your goal is to live a healthy life. Of course, the nutrition strategies and training strategy will be different for professional fitness athletes.

You can achieve extraordinary results and find unusual solutions to your challenging problems by changing the way you eat. I will remind you again that nutrition is one corner of your broader life.  But it is the most important factor which you can control and optimize to get predictive results.

What is Nutrition?

Nutrition is the consumption of fuel which is directly proportional/related to your intelligence, strength and total energy. After reading this post, I believe you will be motivated to define the need of your nutrition and required fuel for your daily activity.

Nutrition in itself is a controversial yet simple subject which you should study with a different mindset. It is important to think about your personal problems and nutrition strategy that would work for you.

Let`s get started

Are you confused about the food you are eating? Are you attracted towards fats, sugars and packed food?

There is a good reason as your senses are attracted towards the sugar and food as our brain is usually adapts to the environment we are living in. It is always confusing to the beginners and young generations who have been going through a lot of information and suggestions from doctors, dietitians, parents and fellow students. And now, in today`s digital world where information spreads like fire make it more complex to understand. What is true or What is not?

The market of nutrition is getting bigger every day but everything available in the market is not relevant for you if you have a certain goal for yourself.

The consumption of today`s diet will have a long term impact on your body considering the healing and defense mechanism. Nutrition is the field of human life concerned with the construction of cells that will improve your overall experience. It will determine the how you feel and how you age.

Developing your mindset to eat the food “Not for pleasure” but for training and making the construction of your body strong. Just like you use good components to build your home so that it does not fall under harsh environment situations. You body is made up small elements, networks which fights with foreign invaders (harmful microbes) to protect from prospective diseases.

Develop your nutrition plans according to your local environment as your body respond in stimulus with your local environment. People living in India should not consume like people living in Northern Europe or other cold climate countries. The development of nutritional and diet plans is just like a computer code that will run perfectly if all the small features or steps are handled with good care.

I am giving these unusual examples to make you understand the concept nutrition in an interdisciplinary context.  Eating for fuel and healthy life is less glamorous as eating for pleasure like a king. There is a small percentage of population which are deeply interested in understanding the functioning of nutrition. And the study of nutrition is not a scientific skills but a life skill. It should be studied by everyone  not just by researchers and science institutes.

The basic steps to get complete control over your nutrition

  1. Firstly, Discard all the packed food that are unhealthy. There is no “its not so bad food”. If it`s bad it is bad.
  2. Secondly, Define your objectives of your healthy life or fitness goals. It should not be in terms of muscle size or fat percentage if it is not required in your professional life such as modelling or celebrity business.
  3. Thirdly, Identify the basic problems in your nutrition and health and subsequently framing the nutrition that could fit and improve your deficiencies.
  4. There is no magical formula or nutritional plan, but the best you can create and extract from the natural resources according to your goals.
  5. Do not fall for any diet plans that are restrictive diet plans. Restrictive diet plans are the ones that substrate or completely reduce one or more macro/micro nutrients such as carbohydrate, fats or proteins.  This restrictive meals leads to changes in your metabolic activities and microbiota in your gut that can create problems of vitamin deficiency or protective phytochemicals.  It is also important to change your virtual and real environment that is related to food.

For example – 

Low carbs diet is quite popular among youth these days as it gives quick results for weight loss and helps you to tone up your body. But you need to understand the fundamental metabolic process. When a person is consuming less carbohydrates, body obtains its energy from the stored glycogen in fats or muscle tissues and glycogen is a water loving molecule. Glycogen is tightly packed or lets say that it stores a large amount of water and making it really heavy. So, while utilizing glycogen for daily activities, your body is depleting the stores of glycogen along with lot of water molecules in urine which is results into weight loss. But this weight will be regained quickly as soon as you are back in your normal diet.

rice-2853767_960_720

In a recent published research, it was found out that the people consuming low carbohydrate diet by replacing the calories with fats and proteins from animal food had high risk of early mortality. The research shows that people consuming less than 40% or more than 70% calories have high risk of early mortality. It suggest a sweet spot of 50-55% of calories from carbohydrates to be the optimum range for complete human nutrition. This diet is quite popular in North America and Europe which is also making its way in Asian countries. The study suggests that this diet is successful for short term goals but have negative consequences in the long run and therefore it should not be accepted.

Government of UK had already mentioned in the guidelines to consumed a third part of their diet as starchy foods.

Let me give me one more most prominent example on coconut oil- Coconut oil has been in news  for decades for two reasons- “Is it good” or Is it Bad”. Recently, a Harvard Professor made it quite dramatic by saying that coconut oil is pure poison as it contains a big amount of saturated fats which is associated with number of diseases specifically hear problems. On other hand, coconut oil has year of history in south east Asia where people use it for multiple uses as herbal medicine. Asian countries use coconut oil as a superfood in kitchen and considered to have wide range of health benefits.  It is know to help in delivery and prevent any malformations or birth defects. Various research studies have concluded that consumption of coconut flesh or oil does not lead to any cardiovascular problem. But diet and food is just one factor that determines the overall wellness of human being therefore it should be understood by considering your other other lifestyle choices. For ex : If you are consuming excess of meat and dairy based diet which is extremely rich in saturated fats can create some problems if taken along with any oil.

Moreover coconut oil is quite stable and is preferred for cooking as compared to other oils but it is recommended to use it for deep frying.

The most different thing about coconut oil is the presence of medium chain fatty acids which is different to that saturated fatty acid composition of other oils. Therefore, the function and absorption of coconut oil on human body is different as compared to other saturated fats present in meat and dairy products. These medium chain fatty acids are highly soluble in water and do no form micelles/ or oil bodies which increases there absorption and solubility in the body.

Most of all, Epidemiological evidence of millions of people in ASIA consuming coconut oil on regular basis with small percentage of heart related problems as compared to western population where the diet is rich in saturated fats consumed from meat and dairy.

pexels-photo-1171060

 

These contradictory and changing studies makes it hard for the people who do not understand the nutrition and biological concept of healthy food. Therefore, it is also important to know about the HISTORY of NUTRITION and cultural beliefs which plays an important role in the wellness of human health.

Learning from this Blog- Learn history of nutrition, cultural beliefs and eat local

Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉

 

screenshot_2018-06-08-18-59-55.png

 

 

Interesting facts about Genes

The earth is a mix of many genes of humans, animals, viruses, bacteria, shark and so on. Just think of every living life and think why is it like this?  It`s all about genes.

Did you wonder if the number of genes can make a difference in your life? And the crazier fact is that these genes are not constant. They are always evolving and changing becoming better or furious. It depends of what we are talking about. Over here, I am only going to talk about numbers, Just numbers. And its going to blow your mind.

Q1. How many genes are there in Humans?

A1. Its about 100,000.

Q2. Do we know the function of all the genes in humans?

A2. No. We only know the function of about 19,000-20,000 genes which are known as protein coding genes.

Q3. What about other 80,000 genes?

A3. Earlier they consider them to be non-functional genes (non coding) but the theories are changing stating that they have an effect on function of 20,000 protein coding genes.

Q4. What is the most popular gene in Humans?

A4.  The gene is known as TP53. It`s role is to protect you from the cancer.

If there is a technology or a strategy that can make this gene so strong that it never under goes mutations. There will be no case of cancer in the world.

Well this is something about genes in humans. What about the genes in other living life?

Q5. When was the first tiger genome published?

A5. 2013

Q6. How many genes are there in a tiger?

A6. Researchers reported 20,226  protein coding genes and 2,935 non coding genes. Well the numbers can change with advancement in technology.

Q7. When was the first cat genome published? Do you know the name of the Cat?

A7. 2007. The name of the cat is cinnamon.

Q8. How many genes are there in a cat?

A8. Roughly 20,000 genes.

Q9. What percentage of DNA tiger shares with a domestic cat?

A9. 96%

Sometimes I wonder if we put the rest 4% genes from the tiger in a cat that cats does not have, will they become more ferocious like wild tigers.  What if you subtract these 4% genes from the tigers that cats does not have? Will you be able to play with these tigers like you can play with cats?   I am really interested to know more about these 4% genes. 😉 

Q10. How many genes are there in  most common bacteria- E.coli?

A10. It can vary from 4000 to 6000 genes

Do you know that this E.Coli normally live in the intestines of the humans and animals but some types of E.coli can cause intestinal infection include diarrhea, abdominal pain and fever. In some extreme cases, it can also lead to bloody diarrhea, dehydration or even kidney failure.

In this case you usually doctors advise you for a course of antibiotics and other medications. Not only this, there are reports that this along with other set of bacteria have become resistance to these antibiotics.

Q11. How many genes are resistant to antibiotics?

A11. It is a very hard question to answer but out of 4000-6000 genes that are present in E.Coli, there can be 5-10 genes (it can be more) that are resistant to bacteria which can vary in different strains of bacteria.

There is a small or big chance that these genes are present in the E.coli that are growing strong in your intestine.

Let me tell you something about Apple Fruit.

Q12. When was the first Apple genome published?

A12. 2010. It was a collaborative project between countries – New Zealand, USA, Italy, Belgium and France.

Q13. What is the total number of genes in a apple?

A13. A big count of 57000. Wow

Q14. Does the genome of apple reveal something new?

A14. Yes, That it is a fruit crop of temperate region  and the Asian apple is the ancestor not the European apple which was proposed earlier as an ancestor.

Q.15 What about the number of genes in Dinosaur? 😉

A15. Yet to find 😉

 

 

5fc4b7fc-2aa2-4e4c-8459-0b9d801d9ca4_scaled.jpg

 

Geneverine- Wolverine

Chicos y Chicas,

I am going to bring your attention towards a very interesting subject about “Humans love perfection”. There is no hidden lie that we humans love perfection and have been using external substances to make us more beautiful and powerful. Isn`t?

There is no lie that we have been using the products made by artificially and genetically modified organisms to grow stronger and stay younger for long age. Do you think that we would have the potential to modify our genes to become more stronger permanently for longer time.  And now you must be wondering if I am trying to promote any technology here but no, its just the basic hypothesis after learning a bit in different laboratories about bioinformatics and sequencing technologies.

My fascination towards sequencing and genome analysis has been growing and I wonder if the humans will be able to use these technologies to modify themselves. Ofcourse it`s not possible right now but it can become feasible in coming 50-100 years.

Let me tell you couple of facts to build my story.

It is possible to get the complete sequence information of your genome under 1500$ and it is expected to go down with time and advancement in sequencing technologies. The second one is gene editing technique that can edit the DNA and replace the modified gene in your genome (we expect that it will be done safely in case of humans) 😉

I want to write this article for the general public, so I am going to explain couple of terminologies in a simplest way-

DNA – is everything about you which has only 4 letters (A,G,T,C) and our Human DNA is made up of 3 billion characters i.e., 3 billion letters together of all A,G,T,C.

Genome – is the term for the complete DNA i.e., all the 3 billion letters together is referred as genome. So you can get the information of these 3 billion letters under 1500$. Incredible. Isn`t?

Gene editing- It can be used to make couple of desired changes in these 3 billion letters and ofcourse, it`s not easy and its still not there but it will be there as we have come a long way to play around (literally play) with plants, bacteria and even with some animals.

Although, i am not aware about the complete information of superheroes but I have always been fascinated by wolverine. I wonder if you can really create a wolverine from the scratch and if not from the scratch, can you modify your genes to obtain 1% of what wolverine have? Just imagine that if you have 1% of wolverine, whats its gonna be like.

What kind of super powers you would like to have?

And I am curious to know if I could have more time to live or I should say, more time to live as 25-30 as this time period is the most energetic one where you are open to the real world. In simple terms – you will feel like 25 even if you are 40.

cinescape-603x336-209535.jpg

Ofcourse, many people can do it without artificial introduction of external substances  and live like 25 even they are 40. But there are more than 7 billion people living in this earth and genetic biosphere is quite different in all the locations.

And then, there are big companies claiming that green tea and red wine have anti-ageing effects but I am not sure if its really working or not. Although, there are some evidences by the researchers saying that 25% of  human life is determined by variations in our DNA i.e., that variations in our 3 billion letters. On the other, people have already found out the information of DNA of the people who have already lived more than 100 years.

So, I asked myself a question, will it possible that in 2065, Humans will have full right to modify there own DNA. Will there be any ethical questions on it? I can understand the ethical points when we are experimenting with animals. There are ethical rights but whats gonna happen when humans will have the opportunity to modify themselves.

Lets just say that in 2065, the age 25= age 40. 

 

Options after MBBS- India

Today, I was talking to my friend Manoj who has recently become a Doctor from a renowned college “MAMC”, India. And I was talking to him about his future plans which lead to many questions regarding the present situation of students pursuing MBBS and Bachelor of Dental Studies in India. Also, my sister and some of my family member are into this field, so i can completely understand the struggle of first getting a position in a Government college to pursue your graduation, then more struggle for MD, MS and then to get a Job. Its completely fine if you are really passionate and only want to practice medicine or surgery for the rest of your life. Its going to be little hard to crack  the MD or MS exam in first shot but not impossible considering that there is only 3% chance of you getting admission into a government college. And this 3% is including both reserved and general seats.  According to my research, I could find out that there are total of 30,000 seats in the different fields of medicine and surgery including non clinical field and the number of aspiring students appearing was recorded to be around 100,000.  Lets take it fast forward that you have already completed your MBBS or BDS.

What now?

I am  sure that many of you might be interested  in looking for some new options and if you are flexible to try to some new fields,then there are many things that you can try and have a stable and good life.  Some of my friends pursued there masters in Health Hospital Management and are presently working with multinational companies, hospitals and  Health IT. Before, I go into the details of the options that you can puruse, I want to ask you one question.

Are you active on Digital Media? Do you inspire to become a freelancer or Digital Doctor? Do you think that you have some content or knowledge that other Doctors or health specialist does not have? If yes, please be active on social media like instagram, youtube and facebook. There is big need of real doctors sharing the real knowledge in  social media.  The smart phones that you are holding in your hands that use to share your problems with your friends and family is the actual answers to all your problems. Share the positive and informative content and make this world a healthy place.

Sin título

Apart from this, you can check these following options …

1.IIHMR is the renowned institution that provides courses in the area of hospital management, pharmaceutical management and public health etc. Not only this, they also have collaboration with John Hopkins to provide study options in the area of health management, public health biology, policies, ethics, environment sciences etc.

https://mph.iihmr.edu.in/

There are several over institutions that provide the similar courses like Manipal University.  https://manipal.edu/som/programs/program-list/mba-healthcare-management.html

2. Combined Medical Services Examination : Is conducted by Union Public Service Commission to train doctors to work in various public organisation such as railways and factories that are functioning under the government of India. The examination has two sets of written exams followed by an interview and personality test.

3. Biomedical Engineering: I think its pretty interesting that having immense knowledge that you can apply in studying the root cause problems of various health related disorders. I am not sure if it will be satisfying at helping a patient in real life. But you will be developing technologies, medicines that can help millions of people. Various institutions in India provide Masters in Biomedical Engineering including most of the IITs.

http://cbme.iitd.ac.in/

4. Clinical Research :  There is big need of conducting clinical trials in India which carries almost 15% of the world population and 20% of disease burden. Recently, it has been reported that there will be change in regulations and policies to conduct the clinical trials to increase the transparency of the results by reducing the approval time-period. So this will create a large number of opportunities.

5.Mental Health- What do you think about the rising level of depression in Indian among youth? I am not sure about the stats but the way we are moving ahead with the depression cases will be the maximum among Indian youth.  Another friend of mine who is also a Doctor, suggested me this option that future Doctors can consider.

6. Public health-  Are you curious about the understanding the impact of overall envrionment and social factors on humans health. Then you can puruse the studies in Public health. TISS is one of the most renowed instute that provides the course entitled Masters in Public Health.

 

 

 

 

Are you sure about yourself?

Do you think that you are 100% Indian, Spanish, French, English or Irish. There is a big chance that you are wrong and  I am going to tell you something that will blow your mind. There is a DNA test that can tell you your exact origin and reunite you with cousins all around the world.  I have never taken it but a lot of people have reviewed this product and are quite surprised to know that they 20% British, 70% spanish and 10% German and so on.

Just imagine, A simple DNA test can tell you the complete ethnicity. My heritage is an online platform developed in Israel that creates the new family based on family trees with global historical records and other features.  This is the simplest test to tell you the real truth of your identity. You will have to order the kit, swipe your cheek with a swap and send the sample to the laboratory. They will analyse your DNA, covert it into digital form and compare it with database to find your close and distance cousins.  It will create new dots for you to join and find your new ancestors. According to there database, the Indian population have ethnicity – 73% South Asian, 10% English, 9% Scandavian, 9% Northwestern European and 6% West Asian.

So do you want to know your real Ethnicity?

DNA-Reuters-L

This test will completely change the meaning of your passport, rules of immigration and citizenship. Also, there will be some theories saying that this will give the big nations more power to control global genetics of the world which can make them easy to manipulate the DNA and control the global health. There are always pros and cons of everything just like social media. It depends on how you use it and how you tackle it.