Students- It`s time for you to make your Science or Business Blog

My fellow researchers and explorers, I am trying to bring your attention towards the biggest platform in front of you- INTERNET. It`s going to be bigger than the journals and your publications in non-reputed journals. I am not saying that it will beat the big journals, but it will help you to build your scientific profile for future scholarship competitions or apply for grants.

It is complete wastage of time and money to publish papers in non-reputed journals that publishes your paper in just 3 days with some money. Does it really make sense? Do you think that these publications will make your profile better than other candidates? I have never met any PhD candidate in Europe or around the world who has publications in these journals. Even if they have, they have improvised with time and learned to publish papers in good journals which take time and real work. But these non-reputed journals who publish paper just in 3 days with little money makes you believe that you have a publication which will just give you false sense of satisfaction. I made the same mistake when I was in 1st and 2nd year of my undergraduate school.

But I learned slowly and gradually by working in different laboratories and what do scientists look in there future PhD students. Surely, they give proper recognition to your experience and published work. But the most important thing they look at is POTENTIAL. How are you going to show this potential? It is confusing for anyone to note the potential in just 30 minutes of skype interview which is competitive as other candidates are also prepared and optimistic for the PhD competition. Isn`t? Even if you have worked really hard and preparing yourself for 3-4 years to compete PhD scholarships. How will you make sure that you are maximizing your impact in that 30 minutes of interview?

If you are taking shortcuts by publishing papers in non-reputed journals, these publications are not helping your profile even 1% in winning the competitive PhD scholarships. Do you think that you are the only one with publication in non-reputed journal? Do you think that the other candidates are not working hard or collaborating with other students to publish paper in better journals?

Looking at the today`s scenario of the PhD world, it has become a market place which needs to be understood properly by aspiring PhD students. As most of the institute as working in collaboration with industries to pursue the industrial interest. So, how can you make our profile interesting for the both industries and academics?

The one of the best way to show your potential and real interest is building up something from the scratch using digital platforms. There will be many students who do not have the equal opportunities to work in well-established laboratories and cannot produce good research publications. But this should not stop you from doing and creating your own online journal. Does this make sense? Scientist and institutes who are hiring or selecting candidates will go through profile carefully and will not miss anything that you have mentioned in your CV. So, if you have produced an online journal conducting your own research, review and discussion from the scratch. It will clearly present the candidate as the potential researcher. But this process is long and requires real determination which will only bring fruitful results if you put in your time and work.

textgram (33).png

Moreover, it will also help you to figure out your research interest in detail if you are really interested in the subject which you can always update, link and connect your research ideas, hypothesis with other researchers around the world. The best time to build you digital profile or science blog is in early undergraduate years or even at high school.

Why? Because, you have no idea about what you really like and what are you going to create. Initially, it wont look like the way you think. It won`t be your best craft but guys you can not understand the consumer behavior by writing just 20 blogs. But with time, you will be able to figure it out and craft it the way you want and that is the real research – your research. Just be brave and share your craziest thought process in words, videos and pictures through digital platforms. There are 4 billion people on internet who are ready to give you there attention. And in todays world, it`s really hard to find attention guys.

There is strong chance of you thinking that if you are putting up the ideas online, there is a chance that anyone can steal it. Everyone has ideas but the main key is the execution. And to convert the idea into an product requires consistent efforts of years not months.

Digital media and research based content creation is the key for future PhD students to become independent or freelance researchers and directly form network with industries or academics

Advertisements

Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉

 

screenshot_2018-06-08-18-59-55.png

 

 

Indian Boy got 2.3 million EUR Funding

An Indian boy got 2.3 million Euros funding from the Government of Italy to create some innovative Enzymes. He is one of the most calm and talented Human being I have never met and his passion is to create innovation projects in Science.

Me- Hey,I know you personally but can you tell my readers little bit about yourself. Like you background and what are you doing now?

Roh- Well basically I’m from Himachal Pradesh, my father is a retired army officer, mother is a house wife and have a younger sister. In 2016 I completed my Bachelor from Amity university, India in Biotechnology. After that I got admission in Masters in Theoretical Chemistry and Computational Modelling in University of Groningen, Netherlands which was funded by Erasmus Mundus. But after completing my 1st semester, I realized that I am not enjoying this course as this course was totally different from my bachelor studies. So, I discussed this issue with my director and she helped me to get another Erasmus Mundus scholarship in Italy for 1st Chemical Nano Engineering Program. This program is launched first time in Europe in collaboration with university of Rome Tor Vergata, Italy , Aix Marseille University, France and Wroclaw University, Poland.

Wow this amazing that your director helped you out with everything. And you got selected for both the scholarships.

Me. Where are you located these days?

Roh. In my hometown, Nurpur, Himachal Pradesh

Great

Me- I read about your grant from the Government of Italy? How did you started this project?

Roh- I started working on this project a year ago before I start my education consultancy company for European education.I am trying to collaborate with universities in Europe for my education consultancy in India and other countries around the globe who wish to pursue there studies in Europe. I got information regarding this funding program by Italy government to launch startup visa for innovation project. I confirmed this with my director Maria of university of Rome tor Vergata, Italy. And I thought that it is a golden opportunity for me to develop something innovative. Then I talked with my mentor in India with whom I have worked in one of my summer internship. He accepted my offer to mentor this project.

So we decided to produce enzyme technology and production unit in India. It took us ` year to develop the basic protocol of the project. We got the approval of our grant on 21st March,2018. And we were ready to launch this startup in Italy.

Me. What kind of enzymes are you going to develop in your industry? Where will your industry be located?

Roh- In the first phase of our project we will develop enzymes by traditional methods by using fermentation menthol. We will manufacture enzymes like Alfa amylase, protease, cellulase, xylanase. All these enzymes are used in different industries of textile, food, detergent, paper, pharmaceutical industries. Our head office is located in Milan and production unit in India. We have already developed the market for 1st phase production and In the second phase, we will be testing our new technology to enhance the overall process of enzyme manufacturing which I cannot disclose right now. As it is still in the process.

Me- What Kind of raw material will you be using to create these enzymes?

Roh- Agriculture waste. We will be using rice husk, wheat brawn and sugarcane waste which are complete waste to the farmers and they usually burn them. So, we are creating values out of the waste. So instead of burning the waste, we will be buying this from farmers which will also give the additional income to the farmers for there waste.

Me- Why are you so interested in this project?

Roh- It will benefit all kind of stakeholders as we are creating something out of the waste. It is estimated that this US enzyme industry will be worth 6.3 billion dollars by 2020. So I thought, it will be a big industry in India too. Although, many companies are already working on it but we still need innovative techniques to build better quality products for many industries.

Me- What are your expectation from your start up in terms of money or Jobs creation?

Roh- I am expecting that this industry will generate 150-200 million euros by 2020. It will create atleast 150-200 jobs.

Me-Have you started employing people?

Roh- Yes we started to hire People for our work

Me- How many people will you be employing?

Roh- We already have team in Italy to manage operation in Europe and We need 20 people in India to start the intial phase of the project.

Me- Can you give some advice to future students?

Roh- I just want to tell student never run for marks and try to do something different. Scores are not everything. Always try to build a network and meet new people. It will give you a chance in your life to make your life better.

Me- Do you think I can upload your public information in my blog so that people can contact you for suggestions.

Roh- Yes ofcourse. And if any one has any innovative idea which they want to turn into reality, I can help them out with the complete process

Are you sure about yourself?

Do you think that you are 100% Indian, Spanish, French, English or Irish. There is a big chance that you are wrong and  I am going to tell you something that will blow your mind. There is a DNA test that can tell you your exact origin and reunite you with cousins all around the world.  I have never taken it but a lot of people have reviewed this product and are quite surprised to know that they 20% British, 70% spanish and 10% German and so on.

Just imagine, A simple DNA test can tell you the complete ethnicity. My heritage is an online platform developed in Israel that creates the new family based on family trees with global historical records and other features.  This is the simplest test to tell you the real truth of your identity. You will have to order the kit, swipe your cheek with a swap and send the sample to the laboratory. They will analyse your DNA, covert it into digital form and compare it with database to find your close and distance cousins.  It will create new dots for you to join and find your new ancestors. According to there database, the Indian population have ethnicity – 73% South Asian, 10% English, 9% Scandavian, 9% Northwestern European and 6% West Asian.

So do you want to know your real Ethnicity?

DNA-Reuters-L

This test will completely change the meaning of your passport, rules of immigration and citizenship. Also, there will be some theories saying that this will give the big nations more power to control global genetics of the world which can make them easy to manipulate the DNA and control the global health. There are always pros and cons of everything just like social media. It depends on how you use it and how you tackle it.

Want to cut your fat?

Are you tired of being fat? Are you tired of spending thousands of dollars in your diet and fitness programs.

Until now we have been doing research on rats by feeding them different types of diet varying the composition of fats, sugar and carbohydrates and checking the impact on overall metabolism of rats by focusing on one or more genes. But with the changing  sequencing technology and super computing power, the progress will be faster to fight obesity. I am sure a big part of community won`t agree with me but I am just sharing the possible real changes that will happen. This community is the one that says that social media is killing the generation but what happened? Technology is winning and it will always win as it exposes people.

Things are changing and big change is already coming in future. It does not matter if you like it or not. You have been using green tea, fat loss program and everyone knows about it. Now, the time to edit some genes in humans is very near. Are you ready to change your genetic structure? Also, we cannot ignore the fact that the rate of obesity or number of unhealthy population is at the maximum the earth has ever seen. So, its the perfect time to introduce the world with the technology that will edit your GENE or GENES related to your belly fat. Isn`t?

Also, I won`t say that consistency and hard work cannot give you the desired fitness results but only if you are consistent and hard working.

What if you are not consistent and istead you are lazy, not at all determined and needs the quick and easy fix? There will be million of people around the world like this. There is a solution in near future for you guys. And this blog is dedicated to the beautiful lazy people who wants to sit and see the cutting of fat from there belly.

One of the major gene that is linked with your obesity is FTO which is around 456820 bp.  Now I am sure most of you will ask what is 456820bp. Bp is base pair and our human DNA is made up of 3 billion base pairs. Now you will ask what is a base pair? There are 4 base pair i.e., A,G,C and T and our human DNA of 3 billion base pair is made up of only 4 letters [A,G,T,C] in different combinations. Each living being on this earth- humans, dogs, plants. insects, cats everyone has these base pairs but all of them have different number of base pairs.

So, the overall bad weight [fat] will vary according to the types of FTO you have in your DNA i.e., it has been noted that if have two variants, you are expected to have 3kgs more as compared to normal human being. In addition to that, some researchers have found certain regions in your DNA that are linked with obesity and these certain regions contain many gene that have different role in management of overall weight. Well, i am not sure if this will require to edit or omit the complete 456820 genes from your DNA.

 

What do you think if you could edit these genes completely and never get fat?

Will you do it?