How to win Scholarships?

The next series of posts are needed because of lots of young people have been asking repetitive questions related to studying abroad and winning scholarships. Especially for students from low-income countries or who wants to win scholarships to keep their financial status better while they are studying and living abroad. Chances are if you are reading this blog, you want to study abroad and live a unique experience.

This section of the blog is written to guide undergraduate and Master`s students to develop there academic and non-academic profile which can help them to win International Scholarships and work abroad. Students always have different questions and doubts about the essential requirements to win scholarship and funding at the national or international level. Although there are many blogs and information available on the internet along with certain personal experiences.

As no such detailed experience is available, so I am sharing my journey with unusual and exciting experiences, traveling and networking. Once you have read this series, you can use this unique and untapped strategy as a reference or template to develop your unique ideas.

It took me a lot of hit and trials to design my own toolbox to learn both within and outside the framework of the University. Both play an essential role especially if you want to stay in academics and wants to win the scholarship. But once I figured out the potential opportunities that we have today is exponential.

Nobody in the past – your parents, your elder siblings or your grandparents had these opportunities. By the end of my Undergraduate school, I had already won two short scholarships, obtained 4 good recommendation letters and immense experience in both academic and non-academic fields.

What was the golden rule behind this efficiency? Consistent networking and communication.



And it is time to accept the truth that simply scoring the top grades won`t win you an International scholarship. Therefore, when you prepare for the final task to apply for scholarships, it will be tiring to prepare for completely new things in quick time.  In contrast, I adopted and worked on the skills by spending time in various events and volunteering where I could learn more by eliminating the excess pressure in Undergraduate school.

After completing my graduate school, I got won two International scholarships to conduct research in Spain and then in Canada. A lot of undergraduate students started texting me to know the secret. Fascinated to realize, I have jotted down some points that I had done differently made me realize that I should share these tips with future undergraduate kids. So, I thought writing this new series of blogs which could be the easiest way to share these untapped strategies.


It will discuss the simple yet effective ways to build your overall profile and develop networking skills while you are studying in School or University. The detailed tips and tools will help students, especially if you are not from a top-tier college or have poor grades in their previous semesters. However, the student needs to show determination and constant hunger to look for more clarity in this experiential journey. Now, you have multiple ways to improvise your profile to compete in both academic and non-academic industries

In the upcoming blogs, you will find the detailed experiences of undergraduate school, my internships, case studies fellowships, summer schools, and networking that I could share in words.

Stay Tuned…



Find your PhD- Best websites and quotes

PhD is the garden of the questions. If you keep your mind and heart open, you will able to find all the answers to all the mysteries. Although a PhD student search for the universe, just to find his own. His soul always search for wisdom rather than the publications. Please bring in the magic back in PhD. Here is my contribution to help my fellow colleagues to search there PhD and lab partners.

textgram (18)


textgram (20)


textgram (21)


textgram (22)

textgram (23)

textgram (24)

textgram (25)

textgram (26)

textgram (27)

textgram (28)

textgram (29)

textgram (30)

textgram (31)



Digital Guru Talks with Indian Youth

Adapting to sudden change in the world and reinventions are the important concepts that are not taught in the structured education system. And we are not accustomed to the change but we will have to learn to accept the change of technology and reinventing our self with time. This changing and fast technology called Internet is making things better at all level if we look at the positive side of it. This is the only technology that has brought the world more closer, accessible by providing equal opportunity in every field. I am not saying that it is easy but there are almost 4 billion internet users who are there to listen to you. They are giving you there attention. Isnt? Ofcourse, there are always consequences, there will always be people in the world with bad news which will blast and spread like fire all over the internet. But internet is an open platform open to both good and bad news. So, there is equal opportunity for good news to blast but only if we want it, which will require consistent efforts from your side. We have unlimited opportunities and we cannot escape or give excuses anymore.

This piece of content is going to be hard to read for the Indian youth as Digital Guru (DG) asked them a simple question and had a much needed conversation on- “What is the most common trait you see in the behavior of today`s youth”.

Surprisingly, Digital guru got so many answers like -herd mentality, life sucks, wants to be extraordinary by doing ordinary things, wants everything easily, lazy but creative, short term benefits, defensive attitude, succumbing, expectations, trust, anger, rebellious, lack of perseverance but digital guru thinks that youth sucks. I think, most of the youth will be able to relate yourself in the below conversation.

Youth – I think there is a need of realization of how youth have no curiosity, no humanity, aimless and running after material stuff.

DG- So what do you think we should do? What is the real solution?

Youth- We need to work on the roots.

DG- I agree but how?

Youth- They have to undergo self realization, introspect themselves to become a better person. Technology is at par which makes us feel less grateful to the real things in life. Well, I worked with kids in the untouched areas of the country at the root level for a month which is very important. I realized that It is not about education, its beyond that. The girls and boys were interested in learning about the environment and how important it was for them to save the indigenous crops of there place. The world is busy running its own business. If we have to make an impact it can never be done alone, if we become aware of something we should keep trying to make others aware of it. In the end the impact needs to be on a large scale and not just to ourselves. But I think it is next to possible because everything is driven with greed and selfishness. Everyone wants to have more without putting in any efforts.

DG- I have few points- I don`t think that technology is going to change at all. Its going to get bigger and you cannot stop it. And these indigenous kids are completely aware about the environment but are not aware about the technology which I believe should be the main point of concern. They should be made aware of the technology in a positive way.

My question is that Do you think that Internet is the solution to all the questions?

Youth- Nope.

DG- Why? There are almost 4 billion internet users and you can reach to all of them.

Youth- Its not just about reaching these people, its about influencing their mindset. For ex: one guy in my social media tagged a few people in a post wherein a machine was installed to dispense 5rs for every plastic bottle deposited in it. She asked the society if this was a good initiative and did the hasttag of world`s environment day. I saw two things – 1. No body gives a shit. 2. Some of the people made fun of her as she made the hashtag on some other date as world environment day is celebrate on 5th June.

DG- I think you are too soft. Just couple of guys made fun of you does not mean that Internet is not the solution. Just one post in not going to change the world and environment. Let me ask you some questions. Do you buy stuff online?

Youth- yes, I do

DG- Did your behavior changed from offline shopping to online shopping?

Youth- Yes

DG- Do you know people along with big business giants didn’t believed and made fun of these guys who started selling things online for ex : Jack Ma “founder of ali baba” who is now a billionaire. But he didn`t become what he is today in just 1 month but it took ages and that ages came along with struggles and hurdles. The sad fact is that we try to escape these hurdles and struggles, so if we really want to educate the people about environment, I believe that Internet is the only way in 21st century. Before it was books, radio, now internet and in future it will be virtual reality.

Youth- Indeed

DG- Like you said, that it would require perseverance and continuous efforts without expecting anything in return for coming 3-4 years and not backing out.

Youth- Yes, I agree

DG- So, do you think that internet is the solution?

Youth- Yes, If its well equipped to influence the people well.

DG- Indeed. Internet is the only solution, I can understand the there is lot of negativity out there which is getting stronger. But I also believe that internet can make positivity louder only if, positive people comes with more optimism.

For now, We were just talking about the environment and education. But Digital guru came across many posts which were filled with complains related to corruption, policies, BJP, congress, Hindu, Muslim etc. These are real problems. I completely agree. Here is one more hard truth and amazing fact that no one told you. These things are not going too change for you or for coming 100 generations. We have learned this fact already in past 70 years of development phase in India. But another incredible fact that you didnt noticed that almost 2 billion people joined internet and social media in 2012 in one way or the other which have your attention. And they are completely mutual and they are not the part of any political party that have only 1000 main players. But these 1000 players are making the good use of Internet. Isn`t?

Do you have problems with Government?

Do you have problems with the changing environment?

Do you have problems with education system?

Let me tell you guys, almost quarter of Indian population is using the Internet which is good enough number to start with the change you want to bring in the society.


Time to do it.

Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉





Indian Boy got 2.3 million EUR Funding

An Indian boy got 2.3 million Euros funding from the Government of Italy to create some innovative Enzymes. He is one of the most calm and talented Human being I have never met and his passion is to create innovation projects in Science.

Me- Hey,I know you personally but can you tell my readers little bit about yourself. Like you background and what are you doing now?

Roh- Well basically I’m from Himachal Pradesh, my father is a retired army officer, mother is a house wife and have a younger sister. In 2016 I completed my Bachelor from Amity university, India in Biotechnology. After that I got admission in Masters in Theoretical Chemistry and Computational Modelling in University of Groningen, Netherlands which was funded by Erasmus Mundus. But after completing my 1st semester, I realized that I am not enjoying this course as this course was totally different from my bachelor studies. So, I discussed this issue with my director and she helped me to get another Erasmus Mundus scholarship in Italy for 1st Chemical Nano Engineering Program. This program is launched first time in Europe in collaboration with university of Rome Tor Vergata, Italy , Aix Marseille University, France and Wroclaw University, Poland.

Wow this amazing that your director helped you out with everything. And you got selected for both the scholarships.

Me. Where are you located these days?

Roh. In my hometown, Nurpur, Himachal Pradesh


Me- I read about your grant from the Government of Italy? How did you started this project?

Roh- I started working on this project a year ago before I start my education consultancy company for European education.I am trying to collaborate with universities in Europe for my education consultancy in India and other countries around the globe who wish to pursue there studies in Europe. I got information regarding this funding program by Italy government to launch startup visa for innovation project. I confirmed this with my director Maria of university of Rome tor Vergata, Italy. And I thought that it is a golden opportunity for me to develop something innovative. Then I talked with my mentor in India with whom I have worked in one of my summer internship. He accepted my offer to mentor this project.

So we decided to produce enzyme technology and production unit in India. It took us ` year to develop the basic protocol of the project. We got the approval of our grant on 21st March,2018. And we were ready to launch this startup in Italy.

Me. What kind of enzymes are you going to develop in your industry? Where will your industry be located?

Roh- In the first phase of our project we will develop enzymes by traditional methods by using fermentation menthol. We will manufacture enzymes like Alfa amylase, protease, cellulase, xylanase. All these enzymes are used in different industries of textile, food, detergent, paper, pharmaceutical industries. Our head office is located in Milan and production unit in India. We have already developed the market for 1st phase production and In the second phase, we will be testing our new technology to enhance the overall process of enzyme manufacturing which I cannot disclose right now. As it is still in the process.

Me- What Kind of raw material will you be using to create these enzymes?

Roh- Agriculture waste. We will be using rice husk, wheat brawn and sugarcane waste which are complete waste to the farmers and they usually burn them. So, we are creating values out of the waste. So instead of burning the waste, we will be buying this from farmers which will also give the additional income to the farmers for there waste.

Me- Why are you so interested in this project?

Roh- It will benefit all kind of stakeholders as we are creating something out of the waste. It is estimated that this US enzyme industry will be worth 6.3 billion dollars by 2020. So I thought, it will be a big industry in India too. Although, many companies are already working on it but we still need innovative techniques to build better quality products for many industries.

Me- What are your expectation from your start up in terms of money or Jobs creation?

Roh- I am expecting that this industry will generate 150-200 million euros by 2020. It will create atleast 150-200 jobs.

Me-Have you started employing people?

Roh- Yes we started to hire People for our work

Me- How many people will you be employing?

Roh- We already have team in Italy to manage operation in Europe and We need 20 people in India to start the intial phase of the project.

Me- Can you give some advice to future students?

Roh- I just want to tell student never run for marks and try to do something different. Scores are not everything. Always try to build a network and meet new people. It will give you a chance in your life to make your life better.

Me- Do you think I can upload your public information in my blog so that people can contact you for suggestions.

Roh- Yes ofcourse. And if any one has any innovative idea which they want to turn into reality, I can help them out with the complete process