Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉





Interesting facts about Genes

The earth is a mix of many genes of humans, animals, viruses, bacteria, shark and so on. Just think of every living life and think why is it like this?  It`s all about genes.

Did you wonder if the number of genes can make a difference in your life? And the crazier fact is that these genes are not constant. They are always evolving and changing becoming better or furious. It depends of what we are talking about. Over here, I am only going to talk about numbers, Just numbers. And its going to blow your mind.

Q1. How many genes are there in Humans?

A1. Its about 100,000.

Q2. Do we know the function of all the genes in humans?

A2. No. We only know the function of about 19,000-20,000 genes which are known as protein coding genes.

Q3. What about other 80,000 genes?

A3. Earlier they consider them to be non-functional genes (non coding) but the theories are changing stating that they have an effect on function of 20,000 protein coding genes.

Q4. What is the most popular gene in Humans?

A4.  The gene is known as TP53. It`s role is to protect you from the cancer.

If there is a technology or a strategy that can make this gene so strong that it never under goes mutations. There will be no case of cancer in the world.

Well this is something about genes in humans. What about the genes in other living life?

Q5. When was the first tiger genome published?

A5. 2013

Q6. How many genes are there in a tiger?

A6. Researchers reported 20,226  protein coding genes and 2,935 non coding genes. Well the numbers can change with advancement in technology.

Q7. When was the first cat genome published? Do you know the name of the Cat?

A7. 2007. The name of the cat is cinnamon.

Q8. How many genes are there in a cat?

A8. Roughly 20,000 genes.

Q9. What percentage of DNA tiger shares with a domestic cat?

A9. 96%

Sometimes I wonder if we put the rest 4% genes from the tiger in a cat that cats does not have, will they become more ferocious like wild tigers.  What if you subtract these 4% genes from the tigers that cats does not have? Will you be able to play with these tigers like you can play with cats?   I am really interested to know more about these 4% genes. 😉 

Q10. How many genes are there in  most common bacteria- E.coli?

A10. It can vary from 4000 to 6000 genes

Do you know that this E.Coli normally live in the intestines of the humans and animals but some types of E.coli can cause intestinal infection include diarrhea, abdominal pain and fever. In some extreme cases, it can also lead to bloody diarrhea, dehydration or even kidney failure.

In this case you usually doctors advise you for a course of antibiotics and other medications. Not only this, there are reports that this along with other set of bacteria have become resistance to these antibiotics.

Q11. How many genes are resistant to antibiotics?

A11. It is a very hard question to answer but out of 4000-6000 genes that are present in E.Coli, there can be 5-10 genes (it can be more) that are resistant to bacteria which can vary in different strains of bacteria.

There is a small or big chance that these genes are present in the E.coli that are growing strong in your intestine.

Let me tell you something about Apple Fruit.

Q12. When was the first Apple genome published?

A12. 2010. It was a collaborative project between countries – New Zealand, USA, Italy, Belgium and France.

Q13. What is the total number of genes in a apple?

A13. A big count of 57000. Wow

Q14. Does the genome of apple reveal something new?

A14. Yes, That it is a fruit crop of temperate region  and the Asian apple is the ancestor not the European apple which was proposed earlier as an ancestor.

Q.15 What about the number of genes in Dinosaur? 😉

A15. Yet to find 😉





Little-Bit about Wine

Of course, you are Interested to know more about wine. And may be some of you or most of you are only interested in drinking but it`s always good to know the process. There is a old saying that its very important to know your wine as it is indeed personal. To know more about wine, it would be good to know brief history about the grapes.

Grapes are one of the oldest domesticated crops discovered nearly 5000-8000 years and out of which more than 50% is used to make vine and 36% of them are eaten fresh. Since then there has been lot of changes in berry size or the overall bunch size depending on the breeding pattern and agricultural style.

In one of the research, it was found out that the grapes that are desired for wine are usually smaller in size usually found in the Christian dominated areas whereas the table grapes or grapes just to eat are of big size that are usually found in Islam dominated regions. They concluded that religious or cultural beliefs have marked a strong impact on the diversity of the Grapes.

Have you ever asked yourself if your wine is natural or industrial?

Natural wine is a wine that produced organically without adding any external substance. But remember, in a natural wine there is nothing added or removed from the start of the wine making until the end.  The wine that comes out after natural process is the wholesome fruits along with all the microbes and sugars that are present in the process. So one of the most important biological cycle which is important in wine making is known as TCA cycle which gives the important intermediates (like basic building blocks) for amino acids and nucleotide synthesis. This cycle also gives the citric acid as one of the intermediate which is important for the wine making process as it is responsible for the aroma and acidity of the wine. In natural wine, there is no addition of citric acid or other similar acids to change the flavor or aroma. As far as i know, the taste and aroma of  the complete natural wine  is going to be really strong with little sugary taste. Sometimes, wine makers complete the fermentation of wine inside the final bottle as it gives the wine more sugary flavor, with some fizzzzz and pulp of the fruit.

Considering the industrial wine, researchers have been doing an incredible job in an interdisciplinary approach to make your wine the best wine and even trying to make the wine as personal as it can become.

I am sure you must be feeling bit lost with statement.

But i wanted to say that a start up called Vinome is claiming that they can provide you the best wine of your life by comparing your DNA and taste buds. The wine they make is unique and is only for your taste buds. But it looks like that they are not joking as they are backed up by the biggest sequencing technology of the world called Ilumina sequencing technology.

Until now, I read that researchers are working on personalized medicine – the medications or treatment according to your DNA, now the personalized wine and in future, science will give us the personalized food, perfumes, and never ending day to day products.

Coming back to wine..


We know that there is massive rise in population, huge demand of good wine, and the attack of changing climate, evolving pathogens that is killing the production of grapes and apples. Moreover, growers are not hesitating to use the deadly chemicals to protect there harvest. And what about the consumers demand of tasty and wooden flavor wine? There are so many questions but no answers.

Do you think that we will be able to produce a good quality wine in 22nd or 23rd century?  😉 

How do we protect the harvest without using chemicals?

Yes there is a solution

With the development of sequencing and genomics technologies, there is a hope that we can try to solve or know the problems occurring in the process of wine-making at early stages of the process. These technologies are the new advancements in the overall agriculture field to identify pathogens in the fields at early stages or develop the crops with traits that are adaptive to the changing climate.

Thanks to genetic diversity 😀

Stay tuned for more update and remember WINE IS ALWAYS FINE

Geneverine- Wolverine

Chicos y Chicas,

I am going to bring your attention towards a very interesting subject about “Humans love perfection”. There is no hidden lie that we humans love perfection and have been using external substances to make us more beautiful and powerful. Isn`t?

There is no lie that we have been using the products made by artificially and genetically modified organisms to grow stronger and stay younger for long age. Do you think that we would have the potential to modify our genes to become more stronger permanently for longer time.  And now you must be wondering if I am trying to promote any technology here but no, its just the basic hypothesis after learning a bit in different laboratories about bioinformatics and sequencing technologies.

My fascination towards sequencing and genome analysis has been growing and I wonder if the humans will be able to use these technologies to modify themselves. Ofcourse it`s not possible right now but it can become feasible in coming 50-100 years.

Let me tell you couple of facts to build my story.

It is possible to get the complete sequence information of your genome under 1500$ and it is expected to go down with time and advancement in sequencing technologies. The second one is gene editing technique that can edit the DNA and replace the modified gene in your genome (we expect that it will be done safely in case of humans) 😉

I want to write this article for the general public, so I am going to explain couple of terminologies in a simplest way-

DNA – is everything about you which has only 4 letters (A,G,T,C) and our Human DNA is made up of 3 billion characters i.e., 3 billion letters together of all A,G,T,C.

Genome – is the term for the complete DNA i.e., all the 3 billion letters together is referred as genome. So you can get the information of these 3 billion letters under 1500$. Incredible. Isn`t?

Gene editing- It can be used to make couple of desired changes in these 3 billion letters and ofcourse, it`s not easy and its still not there but it will be there as we have come a long way to play around (literally play) with plants, bacteria and even with some animals.

Although, i am not aware about the complete information of superheroes but I have always been fascinated by wolverine. I wonder if you can really create a wolverine from the scratch and if not from the scratch, can you modify your genes to obtain 1% of what wolverine have? Just imagine that if you have 1% of wolverine, whats its gonna be like.

What kind of super powers you would like to have?

And I am curious to know if I could have more time to live or I should say, more time to live as 25-30 as this time period is the most energetic one where you are open to the real world. In simple terms – you will feel like 25 even if you are 40.


Ofcourse, many people can do it without artificial introduction of external substances  and live like 25 even they are 40. But there are more than 7 billion people living in this earth and genetic biosphere is quite different in all the locations.

And then, there are big companies claiming that green tea and red wine have anti-ageing effects but I am not sure if its really working or not. Although, there are some evidences by the researchers saying that 25% of  human life is determined by variations in our DNA i.e., that variations in our 3 billion letters. On the other, people have already found out the information of DNA of the people who have already lived more than 100 years.

So, I asked myself a question, will it possible that in 2065, Humans will have full right to modify there own DNA. Will there be any ethical questions on it? I can understand the ethical points when we are experimenting with animals. There are ethical rights but whats gonna happen when humans will have the opportunity to modify themselves.

Lets just say that in 2065, the age 25= age 40. 


Are you sure about yourself?

Do you think that you are 100% Indian, Spanish, French, English or Irish. There is a big chance that you are wrong and  I am going to tell you something that will blow your mind. There is a DNA test that can tell you your exact origin and reunite you with cousins all around the world.  I have never taken it but a lot of people have reviewed this product and are quite surprised to know that they 20% British, 70% spanish and 10% German and so on.

Just imagine, A simple DNA test can tell you the complete ethnicity. My heritage is an online platform developed in Israel that creates the new family based on family trees with global historical records and other features.  This is the simplest test to tell you the real truth of your identity. You will have to order the kit, swipe your cheek with a swap and send the sample to the laboratory. They will analyse your DNA, covert it into digital form and compare it with database to find your close and distance cousins.  It will create new dots for you to join and find your new ancestors. According to there database, the Indian population have ethnicity – 73% South Asian, 10% English, 9% Scandavian, 9% Northwestern European and 6% West Asian.

So do you want to know your real Ethnicity?


This test will completely change the meaning of your passport, rules of immigration and citizenship. Also, there will be some theories saying that this will give the big nations more power to control global genetics of the world which can make them easy to manipulate the DNA and control the global health. There are always pros and cons of everything just like social media. It depends on how you use it and how you tackle it.

Want to cut your fat?

Are you tired of being fat? Are you tired of spending thousands of dollars in your diet and fitness programs.

Until now we have been doing research on rats by feeding them different types of diet varying the composition of fats, sugar and carbohydrates and checking the impact on overall metabolism of rats by focusing on one or more genes. But with the changing  sequencing technology and super computing power, the progress will be faster to fight obesity. I am sure a big part of community won`t agree with me but I am just sharing the possible real changes that will happen. This community is the one that says that social media is killing the generation but what happened? Technology is winning and it will always win as it exposes people.

Things are changing and big change is already coming in future. It does not matter if you like it or not. You have been using green tea, fat loss program and everyone knows about it. Now, the time to edit some genes in humans is very near. Are you ready to change your genetic structure? Also, we cannot ignore the fact that the rate of obesity or number of unhealthy population is at the maximum the earth has ever seen. So, its the perfect time to introduce the world with the technology that will edit your GENE or GENES related to your belly fat. Isn`t?

Also, I won`t say that consistency and hard work cannot give you the desired fitness results but only if you are consistent and hard working.

What if you are not consistent and istead you are lazy, not at all determined and needs the quick and easy fix? There will be million of people around the world like this. There is a solution in near future for you guys. And this blog is dedicated to the beautiful lazy people who wants to sit and see the cutting of fat from there belly.

One of the major gene that is linked with your obesity is FTO which is around 456820 bp.  Now I am sure most of you will ask what is 456820bp. Bp is base pair and our human DNA is made up of 3 billion base pairs. Now you will ask what is a base pair? There are 4 base pair i.e., A,G,C and T and our human DNA of 3 billion base pair is made up of only 4 letters [A,G,T,C] in different combinations. Each living being on this earth- humans, dogs, plants. insects, cats everyone has these base pairs but all of them have different number of base pairs.

So, the overall bad weight [fat] will vary according to the types of FTO you have in your DNA i.e., it has been noted that if have two variants, you are expected to have 3kgs more as compared to normal human being. In addition to that, some researchers have found certain regions in your DNA that are linked with obesity and these certain regions contain many gene that have different role in management of overall weight. Well, i am not sure if this will require to edit or omit the complete 456820 genes from your DNA.


What do you think if you could edit these genes completely and never get fat?

Will you do it? 



Want to get blue eyes?

I am sure, a lot of boys and girls want blue eyes. Isn`t?

Can genetic engineering and DNA sequencing technology make it happen? I believe that it`s gonna come in near future.

I was doing some research on the gene of BLUE eyes and I found out that the gene name called HERC2 is responsible to have blue color eyes in Human beings.  It has been found out that people with blue eyes usually have a mutation in HERC2 that leads to change in the function of another gene called OCA2 which ultimately leads to change in the color of eyes.

But guys, HERC2 is a big gene of 15000-17000 bp. Now I am sure most of you will ask what is 15000 bp. Bp is base pair and our human DNA is made up of 3 billion base pairs. Now you will ask what is a base pair? There are 4 base pair i.e., A,G,C and T and our human DNA of 3 billion base pair is made up of only 4 letters [A,G,T,C] in different combinations. Each living being on this earth- humans, dogs, plants. insects, cats everyone has these base pairs but all of them have different number of base pairs.

So, out of these 3 billion letters, 15000 base pairs makes a gene called HERC2 which is responsible for many small functions in human body. But the interesting one is the change in color of eyes. And geographically, this gene and humans with blue eyes are most prominent in North and East Europe and some parts of North Africa and Americas.

I am not saying that this is going to easy but the cosmetic industry already have there eyes on this gene and they are going to come up with new strategy to get you the blue eyes using DNA sequencing and DNA editing technology.

Just remember a part of HERC2 is the gene of BLUE EYES. It`s coming……