Best European Countries where PhD are well paid

Europe is the best of the continent to pursue your Doctorate studies. Along with nice infrastructure and facilities in the education system, Europe is known for its vibrant cultures, lifestyle, food and the ease of travelling from one country to another. I am writing this blog as an International student for the international students who wish to pursue PhD in Europe.  There are certain problems if our country does not have any diplomatic relations with European Union then, you will have to go through administrative work if you are moving around in Europe for official work. But I will come to this later. Lets talk about the expectation of an International student coming from Asia, south America or North America. I have hardly seen any students pursuing doctorate studies in Europe but there are lot of Asians and South Americans travelling to Europe for Higher studies. Maximum number of students expect a good stipend as you are giving commitment to pursue PhD for 3-4 years which is important to keep in your mind before you make any big decision. Everyone is rushing to start PhD in Europe or North America before analyzing the complete situation in detail. Why, I am pressing this issue is because most of the PhD stipend/Scholarship remains constant for the 3-4 years in many countries of Europe.  For ex: If you start your PhD in 2018 which gives a stipend/monthly salary of 1000 euros/month, your salary will remain the same until 2021.

The pattern and style of PhD has completely changes significantly demanding the industrial results instead of real research. The world load in terms of administrative, scientific publications and results has increased where as the time period of PhD has also reduced to 3 years. Considering the economy, lifestyle and other related things, it will be wise for all the PhD students to choose a PhD that funds high salary along with other benefits.  Here is the list of countries in Europe that pay the high salaries for PhD graduates along with other benefits including insurance and pension plans.

BELGIUM

textgram_1529418308.png

 

NETHERLAND

 

textgram_1529418437

 

 

 

DENMARK

 

textgram_1529418703

 

 

 

NORWAY

 

textgram_1529418970

 

SWEDEN

 

textgram_1529419240

 

 

SWITZERLAND

textgram_1529419307

 

 

 

FINLAND

textgram_1529419554

 

GERMANY
textgram_1529420020

 

 

 

AUSTRIA

 

textgram_1529420113

 

 

 

 

 

 

Advertisements

F**K Media and Understand the power of INTERNET

Do you complain about the society, media and government? I am warning you that if you still want the media or big industries to change there work ethic and your life, then its not for you but if you want to understand the power of internet, change we can bring then read my blog. And I decided to write this blog after observing that we are only complaining  and sharing the negative content in the internet instead of sharing positivity and solutions. Internet has become a complaint box with infinite number of complaints which will never get answered. Specifically, I was bit surprised that in the world where you can access the Internet in railways, bus stations and even in airplanes, we are still discussing about Hindu-Muslim debate which is depressing for the whole country. Please try to understand the power of Internet. Internet is the real democracy and we finally have the power in our hands if we use it effectively.

textgram_1529336816.png

The rules and functioning of society is changing faster than ever before, the life  has become so comfortable that we are able to book and place everything online with just one click. Then why can`t we spread love and peace with just one click.

It`s been long time that we are fearing over the big corporate companies controlling  everything and creating the unnecessary fear and negativity among the people around the world. But with internet, we need to open our hands, free our heart, start typing and fill the internet with positivity, love, fear and optimism so that these media companies who are creating the disturbances in terms of religions and society get the hell back down. But it would take effort from each individual and would require to initiate. We all are just trying to find tricks or easy ways out of it by expecting that media and society will change.

Number of internet users in India is expected to reach 500 million by June,2018 and we are still complaining about the media, society and government. India has the second largest number of Internet users globally who all are connected through a common medium which is completely free for everyone to use and share there views and ideas. But we take this opportunity to share what media, society and government has to tell us and dwelling on the points which has been there for long time and dividing the society every now and then. Do you still want to do that for next 50 years or until you die?

So, What`s the solution?

I would like to believe that there are more number of good people than bad people in this world, then how come the Internet is full of negativity and complaints instead of positive content and solutions that brings peace and positive change every single day.  Before, all the platforms were just supporting a certain set of people who had the everything controlled but Internet gives us the complete freedom to every single individual in the society to make the change. It is the magical network where you can send peace, love and and positive solution through a single send button. Words in both book and internet platforms means the same so it`s time for us to stop finding the easy way out and complaining about the problems in the society.  Imagine, how much time it will take to reach to 1000 people in your parents time when they were watching television or reading newspaper to learn about the world. The internet has completely reverse the trend from millions/billions to 1 (case of television or radio) to  1 to millions/billions which is the case of Internet It completely depends on how you use it.

textgram_1529336752.png

We have unlimited alternatives if we understand this technology. Our parents did not had this opportunity to connect with billions of people with all around the world so why do our thoughts are still stuck in there time zone and why are we still complaining about the same issues that existed 30 years before?  We have limitless alternatives to develop and deliver the change we want. Ofcourse, it`s not easy, because complaining and sharing the post without reading it completely is easy.

The problem is that we don`t share our real viewpoints or the solution you think that it is best for the humankind. We do not make an effort to create a positive content instead we debate on what politicians and industries are doing to the environment. Because we think that everyone knows but the media and government is still controlling things.  So we decide not share positivity and peace but instead we prefer to share the viewpoint of negative people who are trying to divide and create a difference in the society and expect them to change. We need to come out of our artificial comfort zone and start working on the change we want to see. The only difference is that they have understood the use of internet and are exploiting it to the maximum.

Digital Guru take on “Obesity in India”

Listen Listen very carefully, being Fat is unhealthy , being Obese is unhealthy and it is going to kill you one day which is the biggest concern for the obese people in India to think and act on it. And, yes I am aware that body shaming is real for kids, women and men but let me tell you one important FACT that society is not going to change. I am giving you the million dollar advice, you got to adapt and change your mind settings to go along with this society every single time.

I was scrolling through various post in top news media reading about body shaming and obesity and how every society should accepts that you are fat. Fuck with society, its your body and your life and I am surprised that these top bloggers with million followers are promoting directly or indirectly “its ok to be fat” rather than promoting the real fact that you are fat and addicted to processed food and sugar and it can kill you. This is real. It is also necessary to ask these soft bloggers- when they write about body shaming and society issues” Who are they asking ? What are they expecting?

Its high time to learn that this is the  part where we can not do anything and it will be really nice if we understand the sad but true fact -“Society wont change” but we can definitely train ourselves to become more strategic to tackle these issues. Everything that is happening to your body is because of you not because of the society or life. Stop being so fucking lazy and stop eating shit food like Maggie and cookies. You are gonna get fat because of the sugar and bad fats that you are eating not because of the society pressure.

They say that people become more anxious, depressed and looses there self esteem when society call them fat? Do you think that this is the problem?

What? I thought Humans are the top most creature in the earth (microbes-rats- cats-cows——–other trillion species————-> HUMANS there is nothing after this). We are are at the top and we get sad if 100 people call us fat. If this true, then humans cannot be the smartest species living in the earth.

Its really surprising that people are talking this concept of body shaming with so much seriousness and making the future generation more soft and scared by blaming the society. We got to understand the simple fact- “Society will not change, it will never change, but you can change yourself with  self control and  a cup of optimism”. Its possible and stop listening to these soft bloggers out in the world promoting obesity indirectly or directly.

Start motivating your unhealthy friend to go for one mile run, 15 min workout or have one month of consuming just healthy diet with no sugar and processed food. This will not the society but will definitely change your life. No one can change the society, not even god.

So you have only two choices –

One is to feel bad,listen to soft bloggers and making yourself feel better for 1 hour or hoping that society will change. Or you can get your favorite running shoes to go for a mile run.

textgram

Digital Guru Talks with Indian Youth

Adapting to sudden change in the world and reinventions are the important concepts that are not taught in the structured education system. And we are not accustomed to the change but we will have to learn to accept the change of technology and reinventing our self with time. This changing and fast technology called Internet is making things better at all level if we look at the positive side of it. This is the only technology that has brought the world more closer, accessible by providing equal opportunity in every field. I am not saying that it is easy but there are almost 4 billion internet users who are there to listen to you. They are giving you there attention. Isnt? Ofcourse, there are always consequences, there will always be people in the world with bad news which will blast and spread like fire all over the internet. But internet is an open platform open to both good and bad news. So, there is equal opportunity for good news to blast but only if we want it, which will require consistent efforts from your side. We have unlimited opportunities and we cannot escape or give excuses anymore.

This piece of content is going to be hard to read for the Indian youth as Digital Guru (DG) asked them a simple question and had a much needed conversation on- “What is the most common trait you see in the behavior of today`s youth”.

Surprisingly, Digital guru got so many answers like -herd mentality, life sucks, wants to be extraordinary by doing ordinary things, wants everything easily, lazy but creative, short term benefits, defensive attitude, succumbing, expectations, trust, anger, rebellious, lack of perseverance but digital guru thinks that youth sucks. I think, most of the youth will be able to relate yourself in the below conversation.

Youth – I think there is a need of realization of how youth have no curiosity, no humanity, aimless and running after material stuff.

DG- So what do you think we should do? What is the real solution?

Youth- We need to work on the roots.

DG- I agree but how?

Youth- They have to undergo self realization, introspect themselves to become a better person. Technology is at par which makes us feel less grateful to the real things in life. Well, I worked with kids in the untouched areas of the country at the root level for a month which is very important. I realized that It is not about education, its beyond that. The girls and boys were interested in learning about the environment and how important it was for them to save the indigenous crops of there place. The world is busy running its own business. If we have to make an impact it can never be done alone, if we become aware of something we should keep trying to make others aware of it. In the end the impact needs to be on a large scale and not just to ourselves. But I think it is next to possible because everything is driven with greed and selfishness. Everyone wants to have more without putting in any efforts.

DG- I have few points- I don`t think that technology is going to change at all. Its going to get bigger and you cannot stop it. And these indigenous kids are completely aware about the environment but are not aware about the technology which I believe should be the main point of concern. They should be made aware of the technology in a positive way.

My question is that Do you think that Internet is the solution to all the questions?

Youth- Nope.

DG- Why? There are almost 4 billion internet users and you can reach to all of them.

Youth- Its not just about reaching these people, its about influencing their mindset. For ex: one guy in my social media tagged a few people in a post wherein a machine was installed to dispense 5rs for every plastic bottle deposited in it. She asked the society if this was a good initiative and did the hasttag of world`s environment day. I saw two things – 1. No body gives a shit. 2. Some of the people made fun of her as she made the hashtag on some other date as world environment day is celebrate on 5th June.

DG- I think you are too soft. Just couple of guys made fun of you does not mean that Internet is not the solution. Just one post in not going to change the world and environment. Let me ask you some questions. Do you buy stuff online?

Youth- yes, I do

DG- Did your behavior changed from offline shopping to online shopping?

Youth- Yes

DG- Do you know people along with big business giants didn’t believed and made fun of these guys who started selling things online for ex : Jack Ma “founder of ali baba” who is now a billionaire. But he didn`t become what he is today in just 1 month but it took ages and that ages came along with struggles and hurdles. The sad fact is that we try to escape these hurdles and struggles, so if we really want to educate the people about environment, I believe that Internet is the only way in 21st century. Before it was books, radio, now internet and in future it will be virtual reality.

Youth- Indeed

DG- Like you said, that it would require perseverance and continuous efforts without expecting anything in return for coming 3-4 years and not backing out.

Youth- Yes, I agree

DG- So, do you think that internet is the solution?

Youth- Yes, If its well equipped to influence the people well.

DG- Indeed. Internet is the only solution, I can understand the there is lot of negativity out there which is getting stronger. But I also believe that internet can make positivity louder only if, positive people comes with more optimism.

For now, We were just talking about the environment and education. But Digital guru came across many posts which were filled with complains related to corruption, policies, BJP, congress, Hindu, Muslim etc. These are real problems. I completely agree. Here is one more hard truth and amazing fact that no one told you. These things are not going too change for you or for coming 100 generations. We have learned this fact already in past 70 years of development phase in India. But another incredible fact that you didnt noticed that almost 2 billion people joined internet and social media in 2012 in one way or the other which have your attention. And they are completely mutual and they are not the part of any political party that have only 1000 main players. But these 1000 players are making the good use of Internet. Isn`t?

Do you have problems with Government?

Do you have problems with the changing environment?

Do you have problems with education system?

Let me tell you guys, almost quarter of Indian population is using the Internet which is good enough number to start with the change you want to bring in the society.

img_20180612_180859_199.jpg

Time to do it.

Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉

 

screenshot_2018-06-08-18-59-55.png

 

 

Indian Boy got 2.3 million EUR Funding

An Indian boy got 2.3 million Euros funding from the Government of Italy to create some innovative Enzymes. He is one of the most calm and talented Human being I have never met and his passion is to create innovation projects in Science.

Me- Hey,I know you personally but can you tell my readers little bit about yourself. Like you background and what are you doing now?

Roh- Well basically I’m from Himachal Pradesh, my father is a retired army officer, mother is a house wife and have a younger sister. In 2016 I completed my Bachelor from Amity university, India in Biotechnology. After that I got admission in Masters in Theoretical Chemistry and Computational Modelling in University of Groningen, Netherlands which was funded by Erasmus Mundus. But after completing my 1st semester, I realized that I am not enjoying this course as this course was totally different from my bachelor studies. So, I discussed this issue with my director and she helped me to get another Erasmus Mundus scholarship in Italy for 1st Chemical Nano Engineering Program. This program is launched first time in Europe in collaboration with university of Rome Tor Vergata, Italy , Aix Marseille University, France and Wroclaw University, Poland.

Wow this amazing that your director helped you out with everything. And you got selected for both the scholarships.

Me. Where are you located these days?

Roh. In my hometown, Nurpur, Himachal Pradesh

Great

Me- I read about your grant from the Government of Italy? How did you started this project?

Roh- I started working on this project a year ago before I start my education consultancy company for European education.I am trying to collaborate with universities in Europe for my education consultancy in India and other countries around the globe who wish to pursue there studies in Europe. I got information regarding this funding program by Italy government to launch startup visa for innovation project. I confirmed this with my director Maria of university of Rome tor Vergata, Italy. And I thought that it is a golden opportunity for me to develop something innovative. Then I talked with my mentor in India with whom I have worked in one of my summer internship. He accepted my offer to mentor this project.

So we decided to produce enzyme technology and production unit in India. It took us ` year to develop the basic protocol of the project. We got the approval of our grant on 21st March,2018. And we were ready to launch this startup in Italy.

Me. What kind of enzymes are you going to develop in your industry? Where will your industry be located?

Roh- In the first phase of our project we will develop enzymes by traditional methods by using fermentation menthol. We will manufacture enzymes like Alfa amylase, protease, cellulase, xylanase. All these enzymes are used in different industries of textile, food, detergent, paper, pharmaceutical industries. Our head office is located in Milan and production unit in India. We have already developed the market for 1st phase production and In the second phase, we will be testing our new technology to enhance the overall process of enzyme manufacturing which I cannot disclose right now. As it is still in the process.

Me- What Kind of raw material will you be using to create these enzymes?

Roh- Agriculture waste. We will be using rice husk, wheat brawn and sugarcane waste which are complete waste to the farmers and they usually burn them. So, we are creating values out of the waste. So instead of burning the waste, we will be buying this from farmers which will also give the additional income to the farmers for there waste.

Me- Why are you so interested in this project?

Roh- It will benefit all kind of stakeholders as we are creating something out of the waste. It is estimated that this US enzyme industry will be worth 6.3 billion dollars by 2020. So I thought, it will be a big industry in India too. Although, many companies are already working on it but we still need innovative techniques to build better quality products for many industries.

Me- What are your expectation from your start up in terms of money or Jobs creation?

Roh- I am expecting that this industry will generate 150-200 million euros by 2020. It will create atleast 150-200 jobs.

Me-Have you started employing people?

Roh- Yes we started to hire People for our work

Me- How many people will you be employing?

Roh- We already have team in Italy to manage operation in Europe and We need 20 people in India to start the intial phase of the project.

Me- Can you give some advice to future students?

Roh- I just want to tell student never run for marks and try to do something different. Scores are not everything. Always try to build a network and meet new people. It will give you a chance in your life to make your life better.

Me- Do you think I can upload your public information in my blog so that people can contact you for suggestions.

Roh- Yes ofcourse. And if any one has any innovative idea which they want to turn into reality, I can help them out with the complete process

Interesting facts about Genes

The earth is a mix of many genes of humans, animals, viruses, bacteria, shark and so on. Just think of every living life and think why is it like this?  It`s all about genes.

Did you wonder if the number of genes can make a difference in your life? And the crazier fact is that these genes are not constant. They are always evolving and changing becoming better or furious. It depends of what we are talking about. Over here, I am only going to talk about numbers, Just numbers. And its going to blow your mind.

Q1. How many genes are there in Humans?

A1. Its about 100,000.

Q2. Do we know the function of all the genes in humans?

A2. No. We only know the function of about 19,000-20,000 genes which are known as protein coding genes.

Q3. What about other 80,000 genes?

A3. Earlier they consider them to be non-functional genes (non coding) but the theories are changing stating that they have an effect on function of 20,000 protein coding genes.

Q4. What is the most popular gene in Humans?

A4.  The gene is known as TP53. It`s role is to protect you from the cancer.

If there is a technology or a strategy that can make this gene so strong that it never under goes mutations. There will be no case of cancer in the world.

Well this is something about genes in humans. What about the genes in other living life?

Q5. When was the first tiger genome published?

A5. 2013

Q6. How many genes are there in a tiger?

A6. Researchers reported 20,226  protein coding genes and 2,935 non coding genes. Well the numbers can change with advancement in technology.

Q7. When was the first cat genome published? Do you know the name of the Cat?

A7. 2007. The name of the cat is cinnamon.

Q8. How many genes are there in a cat?

A8. Roughly 20,000 genes.

Q9. What percentage of DNA tiger shares with a domestic cat?

A9. 96%

Sometimes I wonder if we put the rest 4% genes from the tiger in a cat that cats does not have, will they become more ferocious like wild tigers.  What if you subtract these 4% genes from the tigers that cats does not have? Will you be able to play with these tigers like you can play with cats?   I am really interested to know more about these 4% genes. 😉 

Q10. How many genes are there in  most common bacteria- E.coli?

A10. It can vary from 4000 to 6000 genes

Do you know that this E.Coli normally live in the intestines of the humans and animals but some types of E.coli can cause intestinal infection include diarrhea, abdominal pain and fever. In some extreme cases, it can also lead to bloody diarrhea, dehydration or even kidney failure.

In this case you usually doctors advise you for a course of antibiotics and other medications. Not only this, there are reports that this along with other set of bacteria have become resistance to these antibiotics.

Q11. How many genes are resistant to antibiotics?

A11. It is a very hard question to answer but out of 4000-6000 genes that are present in E.Coli, there can be 5-10 genes (it can be more) that are resistant to bacteria which can vary in different strains of bacteria.

There is a small or big chance that these genes are present in the E.coli that are growing strong in your intestine.

Let me tell you something about Apple Fruit.

Q12. When was the first Apple genome published?

A12. 2010. It was a collaborative project between countries – New Zealand, USA, Italy, Belgium and France.

Q13. What is the total number of genes in a apple?

A13. A big count of 57000. Wow

Q14. Does the genome of apple reveal something new?

A14. Yes, That it is a fruit crop of temperate region  and the Asian apple is the ancestor not the European apple which was proposed earlier as an ancestor.

Q.15 What about the number of genes in Dinosaur? 😉

A15. Yet to find 😉

 

 

5fc4b7fc-2aa2-4e4c-8459-0b9d801d9ca4_scaled.jpg