Billions of Dollars are spent on DNA Sequencing

Billions of tax payers money are used to find the strategy to sequence the tax payers DNA. I am not telling you any conspiracy theory but I am going to tell some interesting facts of new technology that biologist are using to solve various health problems, agriculture issues and so on. But, before I start with it, you must be wondering what is DNA, genome and sequencing? So I am going to explain these in the most simplest words possible.

Q. What is a DNA?

A. DNA is the basic molecule that defines a living being which is used for growth and development of a living form. But if you are someone from non-science background and you really want to put the exact picture of DNA in your mind. Stay with me. Think about a word, for ex- MAHARASHTRA, LONDON, SOUTH KOREA, CHICKEN CURRY. All these words are made of different alphabets and all these words means different things for ex:  Maharashtra, london and South korea are the names of places and chicken curry is the name of the dish. But DNA is made up of only 4 Alphabets A,T,G and C but every living life have different count of these 4 letters. For ex: Humans will have 3 billion of these letters, every living life will have different count of these 4 letters, some will have in 1000s and some will have in millions. Its different for all the living beings.

Q. What is a gene?

A. It is a code of sequence of the letters A,G,T and C in a certain pattern which have a certain function. For ex : AGGTTTCCCAAGG can be a gene that helps your hair to grow or a gene that help you to build muscles. It`s just an example.

Q. What is a Genome?

A. Genome is a complete information about the DNA of a living life. It means that the genome information will give you the detailed information of every inch of any living form – Humans, viruses, bacteria, sharks and so on. It tells us that we are already living in the age of information. This genome information will tell everything about you and your body. 😉

Q. What is DNA sequencing?

A. Sequence is something that is aligned properly in a line or in a structure form. So, DNA sequencing is the correct information of your or a living form DNA in a correct sequence alignment. So, In case we want to study the DNA of your saliva or blood to know deeply about it. We will take the sample of your saliva and extract the DNA and process the sample through a sequencing machine which will give the exact alignment of DNA of your saliva or blood. Lets say that your DNA of saliva looks like this ATCCAGGGGCCCTTAAAGGGCCCCCTT and DNA of tiger saliva looks like this AAAAAAAAATTTTGGGCGCGCGCGCGCCC. These are just examples for you guys to have a bigger picture.

Q. What is a Human genome Project?

A. It is a billion dollar international scientific research project to know the complete information of base pair of DNA that makes a Human being.  It was jointly started and written by US National Institute of Health and Department of Energy. They completed there primary goals of this project by mid 1990s.

Q. Is human genome already available ?

A. Yes, Research Laboratories have obtained the best draft of the Human Genome according to current sequencing technology. There are some parts of human DNA which will be obtained soon with more advancement in the technology. Lets say there are 3 billion letters in Human DNA but we don`t know about 1 million letters in these 3 billion letter code. (Just to give you an idea).

Q.  Now comes the question about owning the genes and Human genome?

A. This question is very important as big companies wants to have patents and copyright for everything. As they already own or have patents to unknown  number of genes in plants and bacteria which is bit scary and some companies have already filed unknown number of patents on research related to genes and human genome which I am not sure if they are being provided the patent. But the information of human genome is completely public and anyone can use this data to study and publish new findings.

Q. What was the cost of overall Human genome project?

A. 3 Billion US dollars which involves the overall cost of the project including technology development. Now in late 2015, the cost of generating the rough draft of human genome is less than $1000

Q. How Human Genome project will help the general public?

A. The researchers claim that this will help the pharmaceutical companies to develop medicines according to your DNA which will be termed as Personalized medicine.

Q. What do you mean by Personalized Medicine?

A.  Medications that is developed only for your DNA so that pharmaceutical industries can create doses and types of medications that are only designed for your DNA. As one human DNA will be different from others. So the dose and timings of the medications will also differ.

I wonder if they thought of personalized nutrition 😉

I am telling you guys, Follow my blog, It`s really important to know about your DNA 😉





Categories: Gene talk

Tags: , , , , , , , , , , , , , , , , ,

Leave a Reply

Fill in your details below or click an icon to log in: Logo

You are commenting using your account. Log Out /  Change )

Google+ photo

You are commenting using your Google+ account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

%d bloggers like this: